View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9074_low_21 (Length: 325)
Name: NF9074_low_21
Description: NF9074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9074_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 98 - 282
Target Start/End: Original strand, 27067622 - 27067806
Alignment:
| Q |
98 |
ataacattgagaaagagtgaaggaagggataaggtggaaagtgtagtgagtttcagtgttgctgtaaccaataatttatagaattaaagtagtttgtact |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27067622 |
ataacattgagaaagagtgaaggaagggataaggtggaaagtgtagtgagtttcagtgttgctgtaagcaataatttatagaattaaagtagtttgtact |
27067721 |
T |
 |
| Q |
198 |
gnnnnnnncaaaataaaattatgttgccatgtaagcaataactgagatttttgatagatcttgtcacggataattttagcattag |
282 |
Q |
| |
|
| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27067722 |
gtttttttcaaaataaaattatgttgtcatgtaagcaataactgagatttttgatagatcttgtcaccgataattttagcattag |
27067806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University