View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9074_low_23 (Length: 279)
Name: NF9074_low_23
Description: NF9074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9074_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 13 - 261
Target Start/End: Complemental strand, 13847015 - 13846751
Alignment:
| Q |
13 |
ataatactattgagagcaagtttattctatttttagaggtggagagcaagnnnnnnnnnnnnnn--ggtacgggtagagcaaggtaaaatgatgagaaat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
13847015 |
ataatactattgagagcaagtttattctatttttagaggtggagggcaagttttttttttttttttggtaagggtagagcaaggtaaaatgatgagaaat |
13846916 |
T |
 |
| Q |
111 |
acatacacttaaattctgttagggaaataagaactaacaaatattagaacaccgc--tatacagcgaactaattgttcacgaaaacatcccgaatgcatt |
208 |
Q |
| |
|
|||| ||||||||||||||| ||||||| ||||||||||||||||||||||| || |||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13846915 |
acatgcacttaaattctgttggggaaatgagaactaacaaatattagaacactgctatatacaacgaactaattgttcacgaaatcatcccgaatgcatt |
13846816 |
T |
 |
| Q |
209 |
actacgtgttaaaatg------------agttgactttaacggaaaacacaatgtttattgttga |
261 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13846815 |
actacgtgctaaaatgaaccacttcaatagttgactttaacggtaaacacaatgtttattgttga |
13846751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University