View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9074_low_26 (Length: 255)
Name: NF9074_low_26
Description: NF9074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9074_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 21 - 238
Target Start/End: Complemental strand, 48449706 - 48449489
Alignment:
| Q |
21 |
agatagctgtcagaataagacctctgcataatggaacgtctacataggtctatgctggagcgtgagcggcgaagaccataacgttcttttgtaatgtcct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48449706 |
agatagctgtcagaataagacctctgcataatggaacgtctacataggtctatgctggagcgcgagcggcgaagaccataacgttcttttgtaatgtcct |
48449607 |
T |
 |
| Q |
121 |
tagttgaagacgttgttggagaggtaggtatgccaactgctgtgtaggccatagcttttgattgttgtgcaagtcagcaagatcctccactatattggat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48449606 |
tagttgaagacgttgttggagaggtaggtatgccaactgctgtgtaggccatagcttttgattgttgtgcaagtcagcaagatactccactatattggat |
48449507 |
T |
 |
| Q |
221 |
ttctgtgaatcaaaaact |
238 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
48449506 |
ttctgtgaatcaaaaact |
48449489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University