View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9074_low_27 (Length: 215)
Name: NF9074_low_27
Description: NF9074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9074_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 23 - 196
Target Start/End: Complemental strand, 31516804 - 31516631
Alignment:
| Q |
23 |
gtcgcaccgttcagctttctaatttaggtcatttccctttaatttccattcaaatctcaaaattactgttaatcatcacaatgattcgtttgtttttgaa |
122 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31516804 |
gtcgcactgttcagctttctaatttaggtcatttccctctaatttccattcaaatctcaaaattactgttaatcatcacaatgattcgtttgtttttgaa |
31516705 |
T |
 |
| Q |
123 |
tttcctgtattcagatataaacggtgatgcattacattccagcattggatttccgcctgcactcaatgtcacca |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31516704 |
tttcctgtattcagatataaacggtgatgcattacattccagcattggatttccgcctgcactcaatgtcacca |
31516631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University