View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9076_high_15 (Length: 243)
Name: NF9076_high_15
Description: NF9076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9076_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 90 - 213
Target Start/End: Complemental strand, 35627759 - 35627636
Alignment:
| Q |
90 |
ctgtgaatttggcaatgtttaacacatcggataactattgaaactttaatttaactaggcatcagttttagcataatttatatacaggtaccttttcctt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35627759 |
ctgtgaatttggcaatgtttaacacatcggataactattgaaactttaatttaactaggcatcagttttagcataatttatatacagataccttttcctt |
35627660 |
T |
 |
| Q |
190 |
atacttagaattcactacgatttt |
213 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35627659 |
atacttagaattcactacgatttt |
35627636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 35627823 - 35627760
Alignment:
| Q |
1 |
attcacggtagaaatgcctcggcacgtgatatttagactcttaacgcgta-cccaacagcctaa |
63 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||| ||||| || |||||||||| |
|
|
| T |
35627823 |
attcacggtagaaatgcctcgggacgtgatacttagactcttaatgcgtatccaaacagcctaa |
35627760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University