View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9076_low_24 (Length: 286)
Name: NF9076_low_24
Description: NF9076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9076_low_24 |
 |  |
|
| [»] scaffold0354 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0354 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: scaffold0354
Description:
Target: scaffold0354; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 277
Target Start/End: Complemental strand, 8259 - 7983
Alignment:
| Q |
1 |
tacatatttataaacaaaaattccttgatgaactagccaaagagtagatcaaatgatttattcccacctactgctaacaaaaatagttacatatcaggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8259 |
tacatatttataaacaaaaattccttgatggactagccaaacagtagatcaaatgatttattcccacctactgctaacaaaaatagttacatatcatgtg |
8160 |
T |
 |
| Q |
101 |
tttctaattaaaatacatattttgaatatcttttcataagctataatctctctaatttttactttgtagattacctgaatgtaagattttggattgtgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8159 |
tttctaattaaaatacatattttgaatatcttttcataagctataatctctctaattttttatttttagattacctgaatgtaagattttggattgtgta |
8060 |
T |
 |
| Q |
201 |
ctataaatttaagggcaaaatgactatcaaataaaacaggaaaagactgtacgttcaaggcatatggtcttctgtgc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8059 |
ctataaatttaagggcaaaatgactatcaaataaaacaggaaaagactatacgttcaaggcatatggtcttctgtgc |
7983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University