View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9076_low_28 (Length: 280)

Name: NF9076_low_28
Description: NF9076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9076_low_28
NF9076_low_28
[»] chr8 (1 HSPs)
chr8 (1-274)||(13452472-13452745)


Alignment Details
Target: chr8 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 13452472 - 13452745
Alignment:
1 cgatgtcgattgtgagaatctctggtctcatgcatcttgacctcgccggaaaccaaatctccggtgagttaccttccgatataggaaaactccgaagact 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13452472 cgatgtcgattgtgagaatctctggtctcatgcatcttgacctcgccggaaaccaaatctccggtgagttaccttccgatataggaaaactccgaagact 13452571  T
101 aagccgcgcgttatttagccgaaaccaactcaccggttcaattcccgattcggttttgaaaatgaaccggcttgcggatttggatttatctatgaaccgg 200  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13452572 gagccgcgcgttatttagccgaaaccaactcaccggttcaattcccgattcggttttgaaaatgaaccggcttgcggatttggatttatctatgaaccgg 13452671  T
201 ataaccggttcgattccggctcggatagggaaaatgcgggttttgtctactttgaaacttgatggtaactccat 274  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13452672 ataaccggttcgattccggctcggatagggaaaatgcgggttttgtctactttgaaacttgatggtaactccat 13452745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University