View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9076_low_30 (Length: 277)
Name: NF9076_low_30
Description: NF9076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9076_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 12 - 234
Target Start/End: Original strand, 8401802 - 8402015
Alignment:
| Q |
12 |
ttggtgttgacattttagacagcaactagttgttgattactaattataaaagtatagttagtaagtagtccttgtcgtcgatctagccat---ttaggac |
108 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8401802 |
ttggtgttgacattttagacaccaactagttgttgattactaattataaaagtatagttagtaagtagtccttgtcgtcgatctagccatttattaggac |
8401901 |
T |
|
| Q |
109 |
aaataaccattcatccaattagcctgctaattaagctttggactgggtctcagtactttaattttataattgatagatagatagatagatttgttacttg |
208 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8401902 |
aaatgaccattcatccaattagcctgctaattaagctttcgactgggtctcagtactttaattttataatt------------gatagatttgttacttg |
8401989 |
T |
|
| Q |
209 |
tgcatataattaatgcatgcctcttt |
234 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
8401990 |
tgcatataattaatgcatgcctcttt |
8402015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University