View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9076_low_31 (Length: 254)
Name: NF9076_low_31
Description: NF9076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9076_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 110 - 243
Target Start/End: Complemental strand, 52396031 - 52395898
Alignment:
| Q |
110 |
aaaattaattttgttaaaaagttgatttaacataaaatgattcatatttatagggagctatgaatgtttggttcctcttttacagatgttgaattgattt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52396031 |
aaaattaattttgttaaaaagttgatttaacataaaatgatccatatttatagggagctatgaatgtctggttcctcttttacagatgttgaattgattt |
52395932 |
T |
|
| Q |
210 |
ttgacatgtttgttgttctcgattagaataattt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
52395931 |
ttgacatgtttgttgttctcgattagaatgattt |
52395898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 52396082 - 52396050
Alignment:
| Q |
1 |
tatgttatcattgcatacatatttataatcttg |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
52396082 |
tatgttatcattgcatacatatttataatcttg |
52396050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University