View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9076_low_33 (Length: 243)

Name: NF9076_low_33
Description: NF9076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9076_low_33
NF9076_low_33
[»] chr1 (2 HSPs)
chr1 (90-213)||(35627636-35627759)
chr1 (1-63)||(35627760-35627823)


Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 90 - 213
Target Start/End: Complemental strand, 35627759 - 35627636
Alignment:
90 ctgtgaatttggcaatgtttaacacatcggataactattgaaactttaatttaactaggcatcagttttagcataatttatatacaggtaccttttcctt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
35627759 ctgtgaatttggcaatgtttaacacatcggataactattgaaactttaatttaactaggcatcagttttagcataatttatatacagataccttttcctt 35627660  T
190 atacttagaattcactacgatttt 213  Q
    ||||||||||||||||||||||||    
35627659 atacttagaattcactacgatttt 35627636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 35627823 - 35627760
Alignment:
1 attcacggtagaaatgcctcggcacgtgatatttagactcttaacgcgta-cccaacagcctaa 63  Q
    |||||||||||||||||||||| |||||||| |||||||||||| ||||| || ||||||||||    
35627823 attcacggtagaaatgcctcgggacgtgatacttagactcttaatgcgtatccaaacagcctaa 35627760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University