View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9076_low_36 (Length: 237)
Name: NF9076_low_36
Description: NF9076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9076_low_36 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 13 - 237
Target Start/End: Original strand, 7081977 - 7082201
Alignment:
| Q |
13 |
agaagtgaagttctaaccttttttcaaagccttcaaaaccagaaaattccattttgggaacaagtnnnnnnnnnnnnnnnnnntagatttggttttagtg |
112 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7081977 |
agaaatgaagttctaatcttttttcaaagccttcaaaaccagaaaattccattttgggaacaagtgagagagggagagatagatagatttggttttagtg |
7082076 |
T |
 |
| Q |
113 |
ttgaagtagaggtgagggaaaggttggggggtgtagttggtatttatagnnnnnnnnnnnnnnnnnagttagagtgagaatgtagagtgtgaggtttgag |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7082077 |
ttgaagtagaggtgagagaaaggttggggggtgtagttggtatttataggtgtgtgtgtgtgtgagagttagagtgagaatgtagagtgtgaggtttgag |
7082176 |
T |
 |
| Q |
213 |
aagagagcatgcgggtgatgaaacc |
237 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
7082177 |
aagagagcatgcgggtgatgaaacc |
7082201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University