View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9076_low_41 (Length: 211)
Name: NF9076_low_41
Description: NF9076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9076_low_41 |
 | |
|
| [»] scaffold0354 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0354 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: scaffold0354
Description:
Target: scaffold0354; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 33 - 195
Target Start/End: Original strand, 8301 - 8463
Alignment:
| Q |
33 |
ctgctcgttccaataactgtgtttaagccatatttacattacactaaacaagaattgatagttatagtaacattttgatttggatacatttactttgctt |
132 |
Q |
| |
|
|||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8301 |
ctgctcctcccaataactgtgtttaagccatatgtacattacactaaacaagaattgatagttatagtaacattttgatttggatacatttactttgctt |
8400 |
T |
|
| Q |
133 |
tccgattcattttttaaaatagttcatcggaggtttatcattgtaccacaacctagtggtagg |
195 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
8401 |
tccgattcattttttaaaatagttcattggaggtttatcattgtaccaaaacctagtggtagg |
8463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 104 - 145
Target Start/End: Complemental strand, 1984499 - 1984458
Alignment:
| Q |
104 |
attttgatttggatacatttactttgctttccgattcatttt |
145 |
Q |
| |
|
||||||||||||||| |||||| |||||||| |||||||||| |
|
|
| T |
1984499 |
attttgatttggatatatttacgttgctttctgattcatttt |
1984458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 104 - 145
Target Start/End: Complemental strand, 6920078 - 6920037
Alignment:
| Q |
104 |
attttgatttggatacatttactttgctttccgattcatttt |
145 |
Q |
| |
|
||||||||||||||||| |||| |||||||| |||||||||| |
|
|
| T |
6920078 |
attttgatttggatacaattaccttgctttctgattcatttt |
6920037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 104 - 145
Target Start/End: Complemental strand, 6941745 - 6941704
Alignment:
| Q |
104 |
attttgatttggatacatttactttgctttccgattcatttt |
145 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
6941745 |
attttgatttggatatatttactttgctttctgattaatttt |
6941704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University