View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9077_high_30 (Length: 279)

Name: NF9077_high_30
Description: NF9077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9077_high_30
NF9077_high_30
[»] chr7 (1 HSPs)
chr7 (18-261)||(46892426-46892669)


Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 46892426 - 46892669
Alignment:
18 ttctcaatcactcttccctattgcacttcttaccaactcatccgtccacgtcatcatgtactcttactacttcctcaccaccgttggtatccgaccgcct 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
46892426 ttctcaatcactcttccctattgcacttcttaccaactcatccgtccacgtcatcatgtactcttactacttcctcaccaccgttggaatccgaccgcct 46892525  T
118 tggaaacgcgtcgttaccgactgccagattgttcagttcgtgttcagcttcgccgtctccggtctcatgctttattatcacttcggatccgatggtggtg 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46892526 tggaaacgcgtcgttaccgactgccagattgttcagttcgtgttcagcttcgccgtctccggtctcatgctttattatcacttcggatccgatggtggtg 46892625  T
218 gatgctctgggatgaaggcttggtgtttcaatgctgtttttaat 261  Q
    |||||| |||||||||||||||||||||||||||||||||||||    
46892626 gatgctgtgggatgaaggcttggtgtttcaatgctgtttttaat 46892669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University