View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9077_high_37 (Length: 201)
Name: NF9077_high_37
Description: NF9077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9077_high_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 12 - 186
Target Start/End: Original strand, 29271485 - 29271659
Alignment:
| Q |
12 |
aaaattatcatttcacccgaatctcaaccatccgagnnnnnnnntagatttttggtaacccttttaagccacaagtccaaccctaaattagctctcaaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29271485 |
aaaattatcatttcacccgaatctcaaccatctgagaaaaaaaatagatttttggtaacccttttaagccacaagtccaaccctaaatcagctctcaaat |
29271584 |
T |
 |
| Q |
112 |
tcttccaccaagttgagagaaaacgaggcttcgttaaaaccgttgattttatctctttattgattcacattctct |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29271585 |
tcttccaccaagttgagagaaaacgaggcttcgttaaaaccgttgattttatctctttattgattcacattctct |
29271659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University