View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9077_high_8 (Length: 555)
Name: NF9077_high_8
Description: NF9077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9077_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-119
Query Start/End: Original strand, 32 - 290
Target Start/End: Original strand, 42085589 - 42085859
Alignment:
| Q |
32 |
cacgcaccatttcgatgtatccttgttcaaattttgattattttttcacttcggatc------------agcgagaaagttgtaatgaagaggtttcgct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42085589 |
cacgcaccatttcgatgtatccttgttcaaattttgattattttttcacttcggatcataaggtcgatcagcgagaaagttgtaatgaagaggtttcgct |
42085688 |
T |
|
| Q |
120 |
gaatcttcctttgccggtggtcggaatacagattttcgggttctaaggcctgcaaagaatgaaactttgggctttccttatgggcctgcctgcaagctct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42085689 |
gaatcttcctttgccggtggtcggaatacagattttcgggttctaaggcctgcagagaatgatactttgggctttccttataggcctgcctgcaagctct |
42085788 |
T |
|
| Q |
220 |
tccactttggactaatgaatggaagttgttattcatactccattttaatctgtaatacacctaccctattt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42085789 |
tccactttggactaatgaatggaagttgttattcatactccattttaatctgtaatacacctaccctattt |
42085859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 145; E-Value: 5e-76
Query Start/End: Original strand, 294 - 534
Target Start/End: Original strand, 42086780 - 42087019
Alignment:
| Q |
294 |
tatcttaaaatcaacaaagttgcggatactttttaccaaatttaggttgaataggtcggatggccttgagaatttattcgtagttcctaactttgcttct |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42086780 |
tatcttaaaatcaacaaagttgcggatactttt-accaagtttaggttgaataggtcggatggccttgagaatttattcgtagttcctaactttgcttct |
42086878 |
T |
|
| Q |
394 |
tgtgctatgttagctggtaagagnnnnnnnnnnnnncttatttcttgcgtcttattaggggtaactgataacccttcttattaaccnnnnnnntaccaag |
493 |
Q |
| |
|
||||||||||||||| ||||||| |||||| ||||||||||||| |||||||| |||||||||||||||||||| |||||| |
|
|
| T |
42086879 |
tgtgctatgttagcttgtaagagtttttagttttttcttattgcttgcgtcttattgggggtaaccgataacccttcttattaaccaaaaaaacaccaag |
42086978 |
T |
|
| Q |
494 |
ttcatcttaattaactgatcatctagagtttaagatgatta |
534 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42086979 |
ttcatcttaattaactgatcttctagagtttaagatgatta |
42087019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University