View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9077_low_46 (Length: 396)
Name: NF9077_low_46
Description: NF9077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9077_low_46 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 322
Target Start/End: Complemental strand, 150309 - 149988
Alignment:
| Q |
1 |
tttttgcatctctattaacaccatgtttgtttagaaattcagctacttctttgtctttatcagctcttgtttttcctctactcattcccatctcttgttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
150309 |
tttttgcatctctattaacaccatgtttgtttagaaattcagctacttctttgtctttatcagctcttgttttccctctactcattcccatctcttgttc |
150210 |
T |
 |
| Q |
101 |
agttcttgaagatgtttctgagcttgtttggtattgttctttccatgctcttgctaaccatagcatttcattaggtttccaaacaggacttacatatttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
150209 |
agttcttgaagatgtttctgagcttgtttggtattgttctttccatgctcttgctaaccatagcatttcattaggtttccaaacaggacttacatatttc |
150110 |
T |
 |
| Q |
201 |
ccttttcttagttgttgatgaacttgttggtctaactcttgtaacctatttccttcttgacaaggcattggtgaatgatcatgagattgtgatgaagttg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
150109 |
ccttttcttagttgttgatgaacttgttgttctaactcttgtaacctatttccttcttgacaaggcattggtgaatgatcatgagattgtgatgaagttg |
150010 |
T |
 |
| Q |
301 |
tctctgatgaagaagcagctaa |
322 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
150009 |
tctctgatgaagaagcagctaa |
149988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University