View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9077_low_63 (Length: 316)
Name: NF9077_low_63
Description: NF9077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9077_low_63 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 282; Significance: 1e-158; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 305
Target Start/End: Complemental strand, 6502891 - 6502589
Alignment:
| Q |
1 |
gtttataatcaatttactgaacgcgtaatttcaacggtccaaatattaataaacaatttatattgaagtatataacaaagaattaatgtgatttttgatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6502891 |
gtttataatcaatttactgaacgcgtaatttcaacggtccaaatattaatcaac--tttatattgaagtatataacaaagaattaatgtgatttttgatg |
6502794 |
T |
 |
| Q |
101 |
attattttgtagacaatggttgcaattagagaggtgacaaaaaatatgataaggcttgggagaagtgggaatggtatagggtatgatcgttttatagtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6502793 |
attattttgtagacaatggttgcaataagagaggtgacaaaaaatatgataaggcttgggagaagtgggaatggtatagggtatgatcgttttatagtga |
6502694 |
T |
 |
| Q |
201 |
tctcaatagggacaggatcaaacaagagtgaacaaaagtacaatgctaagatggttgctaaatggggtgctttgacatggttattcaactctggttcaac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6502693 |
tctcaatagggacaggatcaaacaagagtgagcaaaagtacaatgctaagatggttgctaaatggggtgctttgacatggttattcaactctggttcaac |
6502594 |
T |
 |
| Q |
301 |
accaa |
305 |
Q |
| |
|
||||| |
|
|
| T |
6502593 |
accaa |
6502589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 170 - 289
Target Start/End: Complemental strand, 6508207 - 6508088
Alignment:
| Q |
170 |
aatggtatagggtatgatcgttttatagtgatctcaatagggacaggatcaaacaagagtgaacaaaagtacaatgctaagatggttgctaaatggggtg |
269 |
Q |
| |
|
|||||||||||||||||||||||||| || || || ||||||||||||||||||| ||||| | |||||||||||||||||||| ||||||||||||| |
|
|
| T |
6508207 |
aatggtatagggtatgatcgttttattgttatatccttagggacaggatcaaacaaaagtgagcgcaagtacaatgctaagatggtggctaaatggggtg |
6508108 |
T |
 |
| Q |
270 |
ctttgacatggttattcaac |
289 |
Q |
| |
|
|||| || |||||||||||| |
|
|
| T |
6508107 |
ctttaacttggttattcaac |
6508088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University