View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9077_low_74 (Length: 251)
Name: NF9077_low_74
Description: NF9077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9077_low_74 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 98 - 235
Target Start/End: Original strand, 42800543 - 42800680
Alignment:
| Q |
98 |
ctagaatcttaataaccatagtcatataccacttgggtgnnnnnnnnnnnnnnnnttagatattttctccttcaaatggaagaaggctttccttatgaat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42800543 |
ctagaatcttaataaccatagtcatataccacttgggtgaaaataaaaagaaaaattagatattttctccttcaaatggaagaaggctttccttatgaat |
42800642 |
T |
|
| Q |
198 |
taatatcttacaacataatatttcggctgtaacaccaa |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42800643 |
taatatcttacaacataatatttcggctgtaacaccaa |
42800680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 159 - 206
Target Start/End: Original strand, 42834371 - 42834418
Alignment:
| Q |
159 |
attttctccttcaaatggaagaaggctttccttatgaattaatatctt |
206 |
Q |
| |
|
|||| |||||| ||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
42834371 |
atttgctcctttaaatggatgaaggctttccttatgaattactatctt |
42834418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 40251659 - 40251709
Alignment:
| Q |
157 |
atattttctccttcaaatggaagaaggctttccttatgaattaatatctta |
207 |
Q |
| |
|
|||||| |||||| |||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
40251659 |
atatttgctccttaaaatggaagaaggctttctttatgaatcaatatctta |
40251709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University