View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9078_high_12 (Length: 247)

Name: NF9078_high_12
Description: NF9078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9078_high_12
NF9078_high_12
[»] chr2 (1 HSPs)
chr2 (49-81)||(44159190-44159222)


Alignment Details
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 81
Target Start/End: Original strand, 44159190 - 44159222
Alignment:
49 acgggcacccaaatggttaactacttgtcttac 81  Q
    |||||||||||||||||||||||||||||||||    
44159190 acgggcacccaaatggttaactacttgtcttac 44159222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University