View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9078_high_6 (Length: 344)
Name: NF9078_high_6
Description: NF9078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9078_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 5e-87; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 7 - 173
Target Start/End: Original strand, 40003251 - 40003417
Alignment:
| Q |
7 |
gagaagcagagagtggaggagcacatgggtgggtgttaggttcaaggaattcatgtgagcacatgtgctttctcccttttgttttgtgttttgtgggacc |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40003251 |
gagaagaagagagtggaggagcacatgggtgggtgttaggttcaaggaattcatgtgagcacatgtgctttctcccttttgttttgtgttttgtgggacc |
40003350 |
T |
|
| Q |
107 |
attttttatgccctcacatctcaactccacaacagctcataaatcagtagtactactcctaacgggg |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40003351 |
attttttatgccctcacatctcaactccacaacagctcataaatcagtagtactactcctaacgggg |
40003417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 237 - 344
Target Start/End: Original strand, 40003480 - 40003587
Alignment:
| Q |
237 |
cctcttcatatatctatccacccttctacatgcgcgtttgcttctcatctatctataaacctacatttgattcaatcttattcttactagctaaggttcc |
336 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40003480 |
cctcttcatgtatctatccaccattctacatgcgcgtttgcttctcatctatccataaacctacatttgattcaatcttattcttactagctaaggttcc |
40003579 |
T |
|
| Q |
337 |
ttacaaac |
344 |
Q |
| |
|
|||||||| |
|
|
| T |
40003580 |
ttacaaac |
40003587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University