View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9078_low_15 (Length: 333)
Name: NF9078_low_15
Description: NF9078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9078_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 7e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 18 - 150
Target Start/End: Complemental strand, 3186443 - 3186313
Alignment:
| Q |
18 |
tctcctttggcttttaaacactaacttgctagctaactttctctcatcatcactcaaaaactaaacaatacttacttccttctatcannnnnnnnnnnnn |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3186443 |
tctcctttggcttttaaacactaacttgctagctaactttctctcatcatcactcaaaaactaaacaatacttacttccttctatca--acacacacaca |
3186346 |
T |
 |
| Q |
118 |
tcatgtctactcacttctccacccacttccacc |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3186345 |
tcatgtctactcacttctccacccacttccacc |
3186313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 251 - 285
Target Start/End: Complemental strand, 3186212 - 3186178
Alignment:
| Q |
251 |
aggtaagtctaatatctaataattcattaaattct |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3186212 |
aggtaagtctaatatctaataattcattaaattct |
3186178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University