View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9078_low_27 (Length: 244)

Name: NF9078_low_27
Description: NF9078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9078_low_27
NF9078_low_27
[»] chr4 (6 HSPs)
chr4 (11-244)||(6730050-6730279)
chr4 (37-177)||(6586556-6586696)
chr4 (35-147)||(6817119-6817231)
chr4 (37-168)||(6839235-6839366)
chr4 (37-179)||(6798306-6798436)
chr4 (37-168)||(6755047-6755178)
[»] scaffold0552 (1 HSPs)
scaffold0552 (35-147)||(6602-6714)


Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 11 - 244
Target Start/End: Original strand, 6730050 - 6730279
Alignment:
11 acctgtgggcattggaccggccttaactcagattttggatgctctcagagagctcaaggttgattttgtccgactagagcagactgttacttctaggttg 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
6730050 acctgtgggcattggaccggccttaactcagattttggatgctctcagagagctcaaagttgattttgtccgactagagcagactgttacttctaggttg 6730149  T
111 aatgcagtagaggtcagattagaggtacttgaggatggcattacccaaataccgcgtgggtcgagttctgactaaggtatcagtcagtattgtacaccca 210  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||    
6730150 aatgcagtagaggtcagattagaggtacttgaggatgtcattacccaaataccgcgtgggtcgagttctgactaaggta----tcagtattgtacaccca 6730245  T
211 aagtcctgttagttgtaattgaacctaagatacc 244  Q
    ||||||||||||||||||||||||||||||||||    
6730246 aagtcctgttagttgtaattgaacctaagatacc 6730279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 37 - 177
Target Start/End: Complemental strand, 6586696 - 6586556
Alignment:
37 ctcagattttggatgctctcagagagctcaaggttgattttgtccgactagagcagactgttacttctaggttgaatgcagtagaggtcagattagaggt 136  Q
    ||||||||||||||||| |||||||||||| || ||||||  || ||| ||||| |||||||||| ||||||||||||||||||| || ||||| |||      
6586696 ctcagattttggatgctatcagagagctcagggctgatttcatcagacaagagctgactgttactgctaggttgaatgcagtagatgtgagattggagag 6586597  T
137 acttgaggatggcattacccaaataccgcgtgggtcgagtt 177  Q
     ||||||||||||||| |||| |||| || |||||||||||    
6586596 gcttgaggatggcattgcccacatactgcatgggtcgagtt 6586556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 35 - 147
Target Start/End: Original strand, 6817119 - 6817231
Alignment:
35 aactcagattttggatgctctcagagagctcaaggttgattttgtccgactagagcagactgttacttctaggttgaatgcagtagaggtcagattagag 134  Q
    |||||||||||||||||| |||| |||| ||| || |||||| || ||||||||||||||||||||| ||||||| |||||||||||||||| |||||||    
6817119 aactcagattttggatgccctcaaagagttcagggctgatttcgttcgactagagcagactgttactgctaggttaaatgcagtagaggtcaaattagag 6817218  T
135 gtacttgaggatg 147  Q
       ||||||||||    
6817219 aagcttgaggatg 6817231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 37 - 168
Target Start/End: Original strand, 6839235 - 6839366
Alignment:
37 ctcagattttggatgctctcagagagctcaaggttgattttgtccgactagagcagactgttacttctaggttgaatgcagtagaggtcagattagaggt 136  Q
    ||||||||||||||||  |||||||||||| || |||||||||| |||  ||||||||||||||  ||||||| |||||||||||||| ||||||||||     
6839235 ctcagattttggatgcaatcagagagctcagggctgattttgtcagacacgagcagactgttacagctaggttcaatgcagtagaggtgagattagagga 6839334  T
137 acttgaggatggcattacccaaataccgcgtg 168  Q
     ||||  |||| | ||||||| |||| |||||    
6839335 gcttgctgatgtcgttacccagatacagcgtg 6839366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 37 - 179
Target Start/End: Original strand, 6798306 - 6798436
Alignment:
37 ctcagattttggatgctctcagagagctcaaggttgattttgtccgactagagcagactgttacttctaggttgaatgcagtagaggtcagattagaggt 136  Q
    |||||||||||||||| |||| |||||||| || |||||| |||||||||||||||||||||||            |||||||||||||| ||||||||     
6798306 ctcagattttggatgccctcaaagagctcagggatgatttcgtccgactagagcagactgttac------------tgcagtagaggtcaaattagagga 6798393  T
137 acttgaggatggcattacccaaataccgcgtgggtcgagttct 179  Q
     || ||||||| |||| ||||||||| |||| | |||||||||    
6798394 gctcgaggatgccattgcccaaatactgcgtcgatcgagttct 6798436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 37 - 168
Target Start/End: Original strand, 6755047 - 6755178
Alignment:
37 ctcagattttggatgctctcagagagctcaaggttgattttgtccgactagagcagactgttacttctaggttgaatgcagtagaggtcagattagaggt 136  Q
    |||| ||| |||||||  |||||| ||||| || |||||| ||| ||| ||||||||||||||||  ||||||||||||||||||||| ||||| ||||     
6755047 ctcaaattctggatgccatcagagcgctcagggctgatttcgtcagacaagagcagactgttactagtaggttgaatgcagtagaggtgagattggagga 6755146  T
137 acttgaggatggcattacccaaataccgcgtg 168  Q
     ||||  |||| |||  |||| ||||||||||    
6755147 gcttgctgatgtcatagcccagataccgcgtg 6755178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0552 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold0552
Description:

Target: scaffold0552; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 35 - 147
Target Start/End: Complemental strand, 6714 - 6602
Alignment:
35 aactcagattttggatgctctcagagagctcaaggttgattttgtccgactagagcagactgttacttctaggttgaatgcagtagaggtcagattagag 134  Q
    |||||||||||||||||| |||| |||| ||| || |||||| || ||||||||||||||||||||| ||||||| |||||||||||||||| |||||||    
6714 aactcagattttggatgccctcaaagagttcagggctgatttcgttcgactagagcagactgttactgctaggttaaatgcagtagaggtcaaattagag 6615  T
135 gtacttgaggatg 147  Q
       ||||||||||    
6614 aagcttgaggatg 6602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University