View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9079_high_7 (Length: 221)

Name: NF9079_high_7
Description: NF9079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9079_high_7
NF9079_high_7
[»] chr7 (1 HSPs)
chr7 (5-221)||(37443864-37444074)


Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 5 - 221
Target Start/End: Complemental strand, 37444074 - 37443864
Alignment:
5 gagagagacctgccctttaggctagacccaaacgtttgttaggttgacgggctggggtgttggggtgaaggcggtcagtaggtacttttgtaaatcctaa 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||    
37444074 gagagagacctgccctttaggctagacccaaacgtttgttaggttgacgggctggggtgctggg-tgaaggcggtcagtaggtacttttgtaaatcctaa 37443976  T
105 gtttaaaatcatacatcacataatacgaatttgaaccgcaaccgctatggggacgtaggtaaaattagtctttcttcgttatcaaacgtcgtgtgttctt 204  Q
    ||||||||||||||||     ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
37443975 gtttaaaatcatacat-----aatacgaatttgaaccgcaaccgctatggggacgtaggtaaaattggtctttcttcgttatcaaacgtcgtgtgttctt 37443881  T
205 tcgagttatggagaatt 221  Q
    |||||||||||||||||    
37443880 tcgagttatggagaatt 37443864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University