View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9079_high_7 (Length: 221)
Name: NF9079_high_7
Description: NF9079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9079_high_7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 5 - 221
Target Start/End: Complemental strand, 37444074 - 37443864
Alignment:
| Q |
5 |
gagagagacctgccctttaggctagacccaaacgtttgttaggttgacgggctggggtgttggggtgaaggcggtcagtaggtacttttgtaaatcctaa |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37444074 |
gagagagacctgccctttaggctagacccaaacgtttgttaggttgacgggctggggtgctggg-tgaaggcggtcagtaggtacttttgtaaatcctaa |
37443976 |
T |
 |
| Q |
105 |
gtttaaaatcatacatcacataatacgaatttgaaccgcaaccgctatggggacgtaggtaaaattagtctttcttcgttatcaaacgtcgtgtgttctt |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37443975 |
gtttaaaatcatacat-----aatacgaatttgaaccgcaaccgctatggggacgtaggtaaaattggtctttcttcgttatcaaacgtcgtgtgttctt |
37443881 |
T |
 |
| Q |
205 |
tcgagttatggagaatt |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
37443880 |
tcgagttatggagaatt |
37443864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University