View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9081_low_28 (Length: 310)
Name: NF9081_low_28
Description: NF9081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9081_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 26 - 298
Target Start/End: Complemental strand, 25348655 - 25348384
Alignment:
| Q |
26 |
ctttaatagcaaagggtcatcaaaggaatctaaatgccaccggcaagtattagtaattagttgttatannnnnnnn-accatttcgtccaaatttgaaca |
124 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||||| || || | ||||||||||||||||| | |||||||||| ||||||||||| |
|
|
| T |
25348655 |
ctttaatagcaaagtgccaccaaaggaatctaaatgccactggtaaatgttagtaattagttgttacatttttttttaccatttcgtttaaatttgaaca |
25348556 |
T |
 |
| Q |
125 |
tagaactttcaannnnnnnnccatctctcaaatcagttgagctaccaaccccctaaaataagccgtgaaaaataagcatagaccatatgtatgtgtatgt |
224 |
Q |
| |
|
|||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
25348555 |
tagaactttcaatttttt--ccttagctcaaatcagttgagctaccaaccccctaaaataagccgtgaaaaataagtatagaccgtatgtatgtgtatgt |
25348458 |
T |
 |
| Q |
225 |
tattttttaactagttatttagctcaatgatcgattaatttagaagaccaatctcacactccgaatgatgtcca |
298 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||| |||||||||||| ||| ||||||||| |
|
|
| T |
25348457 |
tattttttaattagttatttagctcaatgaccgattaatttagaagatcaatctcacacttcgagtgatgtcca |
25348384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University