View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9082_high_4 (Length: 290)

Name: NF9082_high_4
Description: NF9082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9082_high_4
NF9082_high_4
[»] chr1 (2 HSPs)
chr1 (9-271)||(595829-596091)
chr1 (223-273)||(3887759-3887809)
[»] chr5 (2 HSPs)
chr5 (56-109)||(30398569-30398622)
chr5 (52-109)||(30714982-30715039)


Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 9 - 271
Target Start/End: Original strand, 595829 - 596091
Alignment:
9 gtttggtgttgtgaaggtgataatgaggccggcggtggtattcaggtttgcgcttttgataatcggggcgttggtcggagctccgtgcccattagaaagt 108  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
595829 gtttggagttgtgaaggtgataatgaggccggcggtggtattcaggtttgcgcttttgataatcggggcgttggtcggagctccgtgcccattagaaagt 595928  T
109 ccgattactcgtatgttcttccacctttttcatttcattgctataaaattgagtttattgaatgtaattacactaggcgaacaccgggcacgactttagt 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |    
595929 ccgattactcgtatgttcttccacctttttcatttcattgctataaaattgagtttattgaatgtaattacactagtcgaacaccggccacgactttaat 596028  T
209 atcaagtatacaaagtttgaatgatttaggacatgtttggattaacaacttatttgcaggtta 271  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
596029 atcaagtatacaaagtttgaatgatttaggacatgtttggattaacaacttatttgcaggtta 596091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 3887809 - 3887759
Alignment:
223 gtttgaatgatttaggacatgtttggattaacaacttatttgcaggttatg 273  Q
    |||||||||||||||||  ||||||||| |||||||||||||||| |||||    
3887809 gtttgaatgatttaggatctgtttggataaacaacttatttgcagcttatg 3887759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 109
Target Start/End: Complemental strand, 30398622 - 30398569
Alignment:
56 ttgcgcttttgataatcggggcgttggtcggagctccgtgcccattagaaagtc 109  Q
    ||||| |||||| ||||||||| | ||||||||||| ||||||||||| |||||    
30398622 ttgcgattttgacaatcggggcatgggtcggagctctgtgcccattagcaagtc 30398569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 109
Target Start/End: Original strand, 30714982 - 30715039
Alignment:
52 aggtttgcgcttttgataatcggggcgttggtcggagctccgtgcccattagaaagtc 109  Q
    |||||| |||||||||| || ||||||| ||||||||||| |||| || |||||||||    
30714982 aggttttcgcttttgatcattggggcgtgggtcggagctctgtgcacaatagaaagtc 30715039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University