View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9082_low_9 (Length: 290)
Name: NF9082_low_9
Description: NF9082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9082_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 9 - 271
Target Start/End: Original strand, 595829 - 596091
Alignment:
| Q |
9 |
gtttggtgttgtgaaggtgataatgaggccggcggtggtattcaggtttgcgcttttgataatcggggcgttggtcggagctccgtgcccattagaaagt |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
595829 |
gtttggagttgtgaaggtgataatgaggccggcggtggtattcaggtttgcgcttttgataatcggggcgttggtcggagctccgtgcccattagaaagt |
595928 |
T |
 |
| Q |
109 |
ccgattactcgtatgttcttccacctttttcatttcattgctataaaattgagtttattgaatgtaattacactaggcgaacaccgggcacgactttagt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| | |
|
|
| T |
595929 |
ccgattactcgtatgttcttccacctttttcatttcattgctataaaattgagtttattgaatgtaattacactagtcgaacaccggccacgactttaat |
596028 |
T |
 |
| Q |
209 |
atcaagtatacaaagtttgaatgatttaggacatgtttggattaacaacttatttgcaggtta |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
596029 |
atcaagtatacaaagtttgaatgatttaggacatgtttggattaacaacttatttgcaggtta |
596091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 3887809 - 3887759
Alignment:
| Q |
223 |
gtttgaatgatttaggacatgtttggattaacaacttatttgcaggttatg |
273 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||| ||||| |
|
|
| T |
3887809 |
gtttgaatgatttaggatctgtttggataaacaacttatttgcagcttatg |
3887759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 109
Target Start/End: Complemental strand, 30398622 - 30398569
Alignment:
| Q |
56 |
ttgcgcttttgataatcggggcgttggtcggagctccgtgcccattagaaagtc |
109 |
Q |
| |
|
||||| |||||| ||||||||| | ||||||||||| ||||||||||| ||||| |
|
|
| T |
30398622 |
ttgcgattttgacaatcggggcatgggtcggagctctgtgcccattagcaagtc |
30398569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 109
Target Start/End: Original strand, 30714982 - 30715039
Alignment:
| Q |
52 |
aggtttgcgcttttgataatcggggcgttggtcggagctccgtgcccattagaaagtc |
109 |
Q |
| |
|
|||||| |||||||||| || ||||||| ||||||||||| |||| || ||||||||| |
|
|
| T |
30714982 |
aggttttcgcttttgatcattggggcgtgggtcggagctctgtgcacaatagaaagtc |
30715039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University