View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9083_high_32 (Length: 237)
Name: NF9083_high_32
Description: NF9083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9083_high_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 14 - 169
Target Start/End: Complemental strand, 32679795 - 32679640
Alignment:
| Q |
14 |
atatggagtctctttcttcatgtagctaagctgttatgatgtgttttacatgatatttgagataacaaacaagtattgttggttttcatcctttgtgggt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32679795 |
atatggagtctctttcttcatgtagctaagctgttaggatgtgttttacatgatatttaagataacaaacaagtattgttggttttcatcctttatgggt |
32679696 |
T |
 |
| Q |
114 |
tgtacctgacttctaaaccttttcatcctttatggttgtacctgacttctaaacct |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32679695 |
tgtacctgacttctaaaccttttcatcctttatggttgtacctgacttctaaacct |
32679640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 96 - 143
Target Start/End: Complemental strand, 32679676 - 32679630
Alignment:
| Q |
96 |
ttttcatcctttgtgggttgtacctgacttctaaaccttttcatcctt |
143 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32679676 |
ttttcatcctttatgg-ttgtacctgacttctaaaccttttcatcctt |
32679630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 14 - 132
Target Start/End: Original strand, 2230492 - 2230609
Alignment:
| Q |
14 |
atatggagtctctttcttcatgtagctaagctgttatgatgtgttttacatgatatttgagataacaaacaagtattgttggttttcatcctttgtgggt |
113 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| || |||| | || |||||||||| | | | |
|
|
| T |
2230492 |
atatggagtctctttcttcatgtggctaagctgttatgatgtgttttacatgatatttgagatagcaaataaatattttcggccttcatccttt-ttgat |
2230590 |
T |
 |
| Q |
114 |
tgtacctgacttctaaacc |
132 |
Q |
| |
|
|||||||| |||||||||| |
|
|
| T |
2230591 |
tgtacctggcttctaaacc |
2230609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 135 - 214
Target Start/End: Original strand, 2230576 - 2230655
Alignment:
| Q |
135 |
ttcatcctttatggttgtacctgacttctaaacctatcaccggaggccttaagttttttcatatccacatattattattc |
214 |
Q |
| |
|
|||||||||| || ||||||||| |||||||||| |||||| ||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
2230576 |
ttcatcctttttgattgtacctggcttctaaaccaatcaccagaggccttaagtttttttatatccatatattattattc |
2230655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 14 - 107
Target Start/End: Complemental strand, 28136113 - 28136025
Alignment:
| Q |
14 |
atatggagtctctttcttcatgtagctaagctgttatgatgtgttttacatgatatttgagataacaaacaagtattgttggttttcatccttt |
107 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
28136113 |
atatggagtctctttcttcatgtagct-----gttatgatgtgttttacatgatatttgagataacaaataagtattgttggctttcatccttt |
28136025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 214
Target Start/End: Complemental strand, 28136035 - 28135955
Alignment:
| Q |
134 |
tttcatcctttatggttgtacctgacttctaaacctatcaccggaggccttaagttttttcatatccacatattattattc |
214 |
Q |
| |
|
||||||||||| | ||||||| | |||||||||| |||||| ||| ||||| |||||||||||||| |||||||||||| |
|
|
| T |
28136035 |
tttcatccttttttattgtacccggcttctaaaccaatcaccagagtccttatgttttttcatatccctatattattattc |
28135955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 18 - 79
Target Start/End: Original strand, 44806734 - 44806795
Alignment:
| Q |
18 |
ggagtctctttcttcatgtagctaagctgttatgatgtgttttacatgatatttgagataac |
79 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44806734 |
ggagtctctttcgtcaagtagctaagctgttatgatgtgttttacatgatatttgagataac |
44806795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 134 - 201
Target Start/End: Original strand, 44806806 - 44806873
Alignment:
| Q |
134 |
tttcatcctttatggttgtacctgacttctaaacctatcaccggaggccttaagttttttcatatcca |
201 |
Q |
| |
|
|||||| |||| || ||||||| | |||||||||| |||||| |||| |||||||||||||||||||| |
|
|
| T |
44806806 |
tttcattctttttgattgtacccggcttctaaaccaatcaccagaggacttaagttttttcatatcca |
44806873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University