View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9083_low_31 (Length: 388)
Name: NF9083_low_31
Description: NF9083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9083_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 22 - 374
Target Start/End: Original strand, 4587884 - 4588236
Alignment:
| Q |
22 |
gatggactatctagattagcagctgagcaactgaaaccgttgaatggtcttgataaagtgaggaaatggattgaagatcgtggattgaagcgagctgcag |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4587884 |
gatggactatctagattagcagctgagcaactgaagccgttgaatggtcttgataaagtgaggaaatggattgaagatcgtggattgaagcgagctgcag |
4587983 |
T |
|
| Q |
122 |
ttaccaatgctccaagaccaaatgcagaactcattctctcaaagcttggtctctcagatttctttcatgctgttattattggtgatgaatgtgaacatgc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4587984 |
ttaccaatgctccaagaccaaatgcagaactcattctctcaaagcttggtctctcagatttctttcatgctgttattattggtgatgaatgtgaacatgc |
4588083 |
T |
|
| Q |
222 |
caagcctcatccagaaccctacttgaaaggtctcgaagctctcaaagcatctaaggatcacacatttatatttgaggtctgttttcttttctacgcctcg |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4588084 |
caagcctcatccagaaccctacttgaaaggtcttgaagctctcaaagcatctaaggatcacacatttatatttgaggtctgttttcttttctacgcctcg |
4588183 |
T |
|
| Q |
322 |
ctacagagtttgttcttattctgcttctaaccaacccattttgtcaccacagg |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4588184 |
ctacagagtttgttcttattctgcttctaaccaacccattttgtcaccacagg |
4588236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University