View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9083_low_56 (Length: 287)
Name: NF9083_low_56
Description: NF9083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9083_low_56 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 7 - 268
Target Start/End: Original strand, 37202396 - 37202657
Alignment:
| Q |
7 |
gagatggacatcacagaggtggtgatgggcttgtcagggaaatagagtttaggcgcccagttaccgttagcattctttccgagagacgtgtccatgcacc |
106 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37202396 |
gagatggatttcacagaggtggtgatgggcttgtcagggaaatagagtttaggcgcccagttaccgttagcattctttccgagagacgtgtccatgcacc |
37202495 |
T |
|
| Q |
107 |
aagagggctgaagggagggaacgacggtgcacgtggtgctaattacattctaaagaaagataagcgaaaggtttatcttggtggtaagaattctgttgag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37202496 |
aagagggctgaagggagggaacgacggtgcacgtggtgctaattacattctaaagaaagataagcgaaaggtttatcttggtggtaagaattctgttgag |
37202595 |
T |
|
| Q |
207 |
gtgcttcctggcgaaattcttcagattttgactcctgggggtggtggatggggctctccagt |
268 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37202596 |
gtgcttcctggcgaaactcttcagattttgactcctgggggtggtggatggggctctccagt |
37202657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University