View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9083_low_72 (Length: 235)
Name: NF9083_low_72
Description: NF9083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9083_low_72 |
 | |
|
| [»] scaffold0160 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0160 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 48 - 221
Target Start/End: Complemental strand, 18733 - 18558
Alignment:
| Q |
48 |
aaaatagagatcctttctttttgggaagaaaaatgttatttt-gacaataatgaattctt-gctaaccatacatagacaagcattgaattagtaagattg |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18733 |
aaaatagagatcctttctttttgggaagaaaaatgttatttttgacaataatgaattctttgctaaccatacatagacaagcattgaattagtaagattg |
18634 |
T |
|
| Q |
146 |
actttaaacttgccatgtgactcgtgatgtgtttgtgagattttttctcatatccagtactaattttgttctatga |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||| ||||||| ||||| |
|
|
| T |
18633 |
actttaaacttgccatgtgactcgtgatgtgttggtgagattttttctcataaccaatactatttttgttttatga |
18558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University