View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9084_high_7 (Length: 227)

Name: NF9084_high_7
Description: NF9084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9084_high_7
NF9084_high_7
[»] chr2 (1 HSPs)
chr2 (22-227)||(4533548-4533753)


Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 22 - 227
Target Start/End: Complemental strand, 4533753 - 4533548
Alignment:
22 catttatagacaattttttagattttatatcatttaatatgagactcttaacacccccttttcatacctatgtttagatttatggaacgtgaatcgagtc 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| | ||||||||||||||||||||||||    
4533753 catttatagacaattttttagattttatatcatttaatatgagactcttaacaccccctcttcatacccatgtcttgatttatggaacgtgaatcgagtc 4533654  T
122 acccgataaaaggctctccaacatatcttgaatatattctaatatgtttagaatttgggttaaaactagaaaatattatgggggatagaaaacagtaatt 221  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4533653 atccgataaaaggctctccaacatatcttgaatatattctaatatgtttagaatttgggttaaaactagaaaatattatgggggatagaaaacagtaatt 4533554  T
222 tctttt 227  Q
    ||||||    
4533553 tctttt 4533548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University