View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9084_low_17 (Length: 227)
Name: NF9084_low_17
Description: NF9084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9084_low_17 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 22 - 227
Target Start/End: Complemental strand, 4533753 - 4533548
Alignment:
| Q |
22 |
catttatagacaattttttagattttatatcatttaatatgagactcttaacacccccttttcatacctatgtttagatttatggaacgtgaatcgagtc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| | |||||||||||||||||||||||| |
|
|
| T |
4533753 |
catttatagacaattttttagattttatatcatttaatatgagactcttaacaccccctcttcatacccatgtcttgatttatggaacgtgaatcgagtc |
4533654 |
T |
 |
| Q |
122 |
acccgataaaaggctctccaacatatcttgaatatattctaatatgtttagaatttgggttaaaactagaaaatattatgggggatagaaaacagtaatt |
221 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4533653 |
atccgataaaaggctctccaacatatcttgaatatattctaatatgtttagaatttgggttaaaactagaaaatattatgggggatagaaaacagtaatt |
4533554 |
T |
 |
| Q |
222 |
tctttt |
227 |
Q |
| |
|
|||||| |
|
|
| T |
4533553 |
tctttt |
4533548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University