View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9086_high_5 (Length: 239)

Name: NF9086_high_5
Description: NF9086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9086_high_5
NF9086_high_5
[»] chr5 (1 HSPs)
chr5 (18-207)||(17434505-17434694)


Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 207
Target Start/End: Original strand, 17434505 - 17434694
Alignment:
18 acttgtgtatgattttttgaataattgagagcaactccatttcaaataattaagaacctaacaaacaaatagattctgatttcagatccctaacacagga 117  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
17434505 acttgtgtatgattttttgaatatttgagagcaactccatttcaaataattaagaacctaacaaacaaatagattctgatttcagatccctaacatagga 17434604  T
118 caaatgttgacccccactcctcttaacatattagatgaactcgaatccttttaacaaaccatatccctaaacaaaacatagtttcacgtt 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
17434605 caaatgttgacccccactcctcttaacatattagatgaactcgaatccttttaacaaaccatatccctaaacaaaacatagtttctcgtt 17434694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University