View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9086_high_5 (Length: 239)
Name: NF9086_high_5
Description: NF9086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9086_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 207
Target Start/End: Original strand, 17434505 - 17434694
Alignment:
| Q |
18 |
acttgtgtatgattttttgaataattgagagcaactccatttcaaataattaagaacctaacaaacaaatagattctgatttcagatccctaacacagga |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17434505 |
acttgtgtatgattttttgaatatttgagagcaactccatttcaaataattaagaacctaacaaacaaatagattctgatttcagatccctaacatagga |
17434604 |
T |
|
| Q |
118 |
caaatgttgacccccactcctcttaacatattagatgaactcgaatccttttaacaaaccatatccctaaacaaaacatagtttcacgtt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17434605 |
caaatgttgacccccactcctcttaacatattagatgaactcgaatccttttaacaaaccatatccctaaacaaaacatagtttctcgtt |
17434694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University