View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9086_high_7 (Length: 236)
Name: NF9086_high_7
Description: NF9086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9086_high_7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 20 - 236
Target Start/End: Original strand, 46892233 - 46892449
Alignment:
| Q |
20 |
ccatctgtttccctcctcatacccctccaaatggtcccctcttcttttgggcctacatcttctacctctcaaaatatcttgaattcattgacactctctt |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892233 |
ccatatgtttccctcctcatacccctccaaatggtcccctcttcttttgggcctacatcttctacctctcaaaatatcttgaattcattgacactctctt |
46892332 |
T |
 |
| Q |
120 |
cataatcctatcaagatccatcaaacgcctctcattcctccacgtgtaccatcattcaaccgtcccagtcatgtgttatctatggcttaattcttctcaa |
219 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892333 |
catcatcctatcaagatccatcaaacgcctctcattcctccacgtgtaccatcattcaaccgtcccagtcatgtgttatctatggcttaattcttctcaa |
46892432 |
T |
 |
| Q |
220 |
tcactcttccctattgc |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
46892433 |
tcactcttccctattgc |
46892449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University