View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9087_low_8 (Length: 305)
Name: NF9087_low_8
Description: NF9087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9087_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 68 - 298
Target Start/End: Original strand, 46556986 - 46557217
Alignment:
| Q |
68 |
gattggttctgtatcaggccataactcagctcgtttaccggtttgtgttagtatcttaatcagtgtatcggtgtcgacagtcccctttacttctactttt |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46556986 |
gattggttctgtatcaggccataactcagctcgtttaccggtttgtgttagtatcttaatcagtgtatcggtgtcgacagtcccctttacttctactttt |
46557085 |
T |
 |
| Q |
168 |
tgttgcttcaaatcaatagttgtttgataaacacctgatttaacaacaatattaacaagagttttgaaatgaaaacaaaaaataacatatattgagtttt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46557086 |
tgttgcttcaaatcaatagttgtttgataaacacctgatttaacaacaatattaacaagagttttgaaatgaaaacaaaaaataacatatattgagtttt |
46557185 |
T |
 |
| Q |
268 |
gaatgttattga-tttgttaccatctctgctt |
298 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||| |
|
|
| T |
46557186 |
gaatgttattgattttgttaccatctatgctt |
46557217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University