View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9088_low_12 (Length: 269)
Name: NF9088_low_12
Description: NF9088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9088_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 12 - 250
Target Start/End: Original strand, 2262029 - 2262267
Alignment:
| Q |
12 |
cacagacaaagaaagagtttatacaaacattgctaattcaaatgcgaaaaatttcactcttaaaccatccaacaagacaataacatctggaggttgggta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2262029 |
cacagacaaagaaagagtttatacaaacattgctaattcaaatgcgaaaaatttcactcttaaaccatccaacaagacaataacatctggaggttgggta |
2262128 |
T |
|
| Q |
112 |
gcaatggaagcaagtagtggcaagatcttatgggccatagctaaccctagtaatgctactgctaatggtcctgttagtgtagctaatggcattgtctttg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2262129 |
gcaatggaagcaagtagtggcaagatcttatgggccatagctaaccctagtaatgctactgctaatggtcctgttagtgtagctaatggcattgtctttg |
2262228 |
T |
|
| Q |
212 |
caggatctgcaaataggaaaggacctatctatgcaataa |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2262229 |
caggatctgcaaataggaaaggacctatctatgcaataa |
2262267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 67
Target Start/End: Complemental strand, 2228775 - 2228731
Alignment:
| Q |
23 |
aaagagtttatacaaacattgctaattcaaatgcgaaaaatttca |
67 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||| |||||||||| |
|
|
| T |
2228775 |
aaagagtttatacaaacattgcaaattcagatgccaaaaatttca |
2228731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University