View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9089_low_4 (Length: 360)
Name: NF9089_low_4
Description: NF9089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9089_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 12 - 198
Target Start/End: Original strand, 36706547 - 36706730
Alignment:
| Q |
12 |
cagtgttattgtgattttgtcaaattcactatgaatccaaatatgcatcatgcatgatgcttgtatattcaatcattaacattccatcaaagttaatttg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36706547 |
cagtgttattgtgattttgtcaaattcactatgaatccaaatatgcatcatgcatgatgcttgtatattcaatcattaacattccatcaaagttaatttg |
36706646 |
T |
|
| Q |
112 |
gactaataaaattttcactcccacccaaggttaccattttttgccagattaacaaaacaacaacaaagaaagtaaagagaaaactgc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
36706647 |
gactaataaaattttcactcccacccaaggttaccattttttgccagattaataa---aacaacaaagaaagtaaagagaaaactgc |
36706730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 291 - 344
Target Start/End: Original strand, 36706830 - 36706883
Alignment:
| Q |
291 |
gagtttaattttgataatgttagcatgaatcactcttaacacttacttagaatt |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36706830 |
gagtttaattttgataatgttagcatgaatcactcttaacacttacttagaatt |
36706883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University