View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9090_high_22 (Length: 359)
Name: NF9090_high_22
Description: NF9090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9090_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 16 - 344
Target Start/End: Complemental strand, 44924014 - 44923714
Alignment:
| Q |
16 |
ctgtggtgtatgtttgtttatcctggaaatgctcatgttcatgtgccacaaaacacaagtccatctgtttgtttaccacaactccctaaggtgtctgtta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44924014 |
ctgtggtgtatgtttgtttatcctggaaatgctcatgttcatgtgccacaaaacacaagtccatctgtttgtttaccacaactccctcaggtgtctgtta |
44923915 |
T |
|
| Q |
116 |
gaaaggacataagtttcattttcttgctggtagttgcaacatagaaaatcacatcttttaatccaccttctttgttcaaagaaagggaatatccctctgg |
215 |
Q |
| |
|
|| | |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
44923914 |
gaga--------------ttttcttgctggtagttgcaacatagaaaatcac--------------cttctttgttcaaagaaagggaattaccctctgg |
44923843 |
T |
|
| Q |
216 |
atccttacctaagtagcacgcataccttgatcaaggtggttacgctactctccttgttcatcaaactgatgaatgcgtccttgaaattgttgcacttttg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44923842 |
atccttacctaagtagcacgcataccttgatcaaggtggttacgctactctccttgttcatcaaactgatgaatgcgtccttgaaattgttgcacttttg |
44923743 |
T |
|
| Q |
316 |
tgtgcgtccaatctgtcaaggttcaaggt |
344 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44923742 |
tgtgcgtccaatctgtcaaggttcaaggt |
44923714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University