View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9090_low_65 (Length: 299)
Name: NF9090_low_65
Description: NF9090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9090_low_65 |
 | |
|
| [»] scaffold0034 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 27 - 168
Target Start/End: Original strand, 3209337 - 3209478
Alignment:
| Q |
27 |
gtcgtcgatggtgaaacggaagaggacgagggggcggtcacggaagaagaagagcaagaactagtcagcgatgatggcgaggaagttgaggttgaaggga |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3209337 |
gtcgtcgatggtgaaacggaagaggacgagggggcggtcatggaagaagaagagcaagaactaggcagcgatgacggcgaggaagttgaggttgaaggga |
3209436 |
T |
|
| Q |
127 |
gagagttgtaagttgggataagattaatggtgtagttgatgc |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3209437 |
gagagttgtaagttgggataagattaatggtgtagttgatgc |
3209478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0034 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: scaffold0034
Description:
Target: scaffold0034; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 27 - 168
Target Start/End: Original strand, 109173 - 109313
Alignment:
| Q |
27 |
gtcgtcgatggtgaaacggaagaggacgagggggcggtcacggaagaagaagagcaagaactagtcagcgatgatggcgaggaagttgaggttgaaggga |
126 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||| ||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
109173 |
gtcgtcgatggtgaaacggaagaggacgaaggg-cggtcatggaagaagaagagcaagaactaggcagcgatgacggcgaggaagttgaggttgaaggga |
109271 |
T |
|
| Q |
127 |
gagagttgtaagttgggataagattaatggtgtagttgatgc |
168 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
109272 |
gagagttgtaagttgggataaaattaatgatgtagttgatgc |
109313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 34 - 87
Target Start/End: Complemental strand, 31283167 - 31283114
Alignment:
| Q |
34 |
atggtgaaacggaagaggacgagggggcggtcacggaagaagaagagcaagaac |
87 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
31283167 |
atggtgaaacggaagaggacgacggggcggtcacggaagaagaaaagcaagaac |
31283114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 108 - 156
Target Start/End: Complemental strand, 31282882 - 31282834
Alignment:
| Q |
108 |
gaagttgaggttgaagggagagagttgtaagttgggataagattaatgg |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
31282882 |
gaagttgaggttgaagggagagagttgtaagttggagtaggattaatgg |
31282834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University