View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9090_low_66 (Length: 287)
Name: NF9090_low_66
Description: NF9090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9090_low_66 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 33940927 - 33940719
Alignment:
| Q |
18 |
gtggggttatgcccaattaagaatttctcgatagcttaattgatttgattgacttgagctaaaagttaaagagttagaggtcttaggttaaaaaattgaa |
117 |
Q |
| |
|
||||| |||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33940927 |
gtgggattatgcccaattaagagtttctcggtagcttaattgatttgattgacttgagctaaaagttaaagagttagaggtcttaggttaaaaaattgaa |
33940828 |
T |
|
| Q |
118 |
ggaattccttaatattaattttacaaataattactaatatttgttattnnnnnnnnnnnnnntaccaatgcaatcacaatataaaatcttgatatcggat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33940827 |
ggaattccttaatattaattttacaaataattactaacatttgttttt---aaaaaaaataataccaatgcaatcacaatataaaatcttgatataggat |
33940731 |
T |
|
| Q |
218 |
tgctacatatac |
229 |
Q |
| |
|
||| |||||||| |
|
|
| T |
33940730 |
tgcaacatatac |
33940719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University