View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9090_low_76 (Length: 238)
Name: NF9090_low_76
Description: NF9090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9090_low_76 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 14818913 - 14819133
Alignment:
| Q |
16 |
caattatgtgcttgagaaattggttagcaaaacccatcgttaaaaatgtcacattgtacacaataatgaacatatatggttgttgagttaatcttgttat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14818913 |
caattatgtgcttgagaaattggttagcaaaacccattgttaaaaatgtcacattgtacgcaataatgaacatatatggttgttgagttaatcttgttat |
14819012 |
T |
 |
| Q |
116 |
ttagcaataatgaacagatgatagctataaatgaccatttaataatggaactttttcatgtcgattgttcattgatcaattctccatgtccctttctttg |
215 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14819013 |
ttagtaataatgaacagatgatagctataaatgatcatttaataatggaactttttcatgtcgattgttcattgatcaattctccatgtccctttctttg |
14819112 |
T |
 |
| Q |
216 |
gatatatggactacaacgtac |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
14819113 |
gatatatggactacaacgtac |
14819133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University