View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9090_low_79 (Length: 233)
Name: NF9090_low_79
Description: NF9090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9090_low_79 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 16 - 218
Target Start/End: Original strand, 40772496 - 40772693
Alignment:
| Q |
16 |
agaggaatcaatttccattgtcaattcaataaccatataaactagtcaaatggattaaaacaac-gtgttagtcagatggactaacacaattccaagtga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||| | |||||||||||||||||||||||||| |||||||| |
|
|
| T |
40772496 |
agaggaatcaatttccattgtcaattcaataac--tgtaaactagtcagatggattaaaacatctgtgttagtcagatggactaacacaatcccaagtga |
40772593 |
T |
 |
| Q |
115 |
ggacttaccagggccggtctagtatatacaaatccttgagcagatttttcccatctgcacccccaagcacaaacagtttattaccaatagtcccttggag |
214 |
Q |
| |
|
|||||||| | |||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
40772594 |
ggacttactgg----tgtctggtatatacaaatccttgagcagatttttcccatctgcacctccaagcacaaacagtttatcaccaacagtcccttggag |
40772689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University