View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9092_low_12 (Length: 294)
Name: NF9092_low_12
Description: NF9092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9092_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 7e-89; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 35 - 240
Target Start/End: Complemental strand, 53918474 - 53918269
Alignment:
| Q |
35 |
cacacactataagaaatatgctatttgccagggattttgatagggacattaaacccttggcaaattttagccaaggaaaatccccggtaaaatgacattg |
134 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
53918474 |
cacacactacaagaaatatgctatttgccagagattttgatagggacattaaacccttggcaaattttagccaaggaaaatccctgacaaaatgacattg |
53918375 |
T |
 |
| Q |
135 |
ttaagtctgggaccacttaccatttgacagggatgagccccttacaaatgtacacatgcccctggattgagttgaccgcgaaatggaatttcaaattggc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
53918374 |
ctaagtctgggaccacttaccatttgacagggatgagccccttacaaatgtacacgtgcccccaggttgagttgaccgcgaaatggaatttcaaattggc |
53918275 |
T |
 |
| Q |
235 |
tgacat |
240 |
Q |
| |
|
|||||| |
|
|
| T |
53918274 |
tgacat |
53918269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 241 - 272
Target Start/End: Complemental strand, 52628839 - 52628808
Alignment:
| Q |
241 |
caacggcgaagctagcaaaaagtttatgcagg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52628839 |
caacggcgaagctagcaaaaagtttatgcagg |
52628808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 38 - 101
Target Start/End: Original strand, 18912801 - 18912865
Alignment:
| Q |
38 |
acactataagaaatatg-ctatttgccagggattttgatagggacattaaacccttggcaaattt |
101 |
Q |
| |
|
|||||| |||||| ||| |||||||||||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
18912801 |
acactacaagaaaaatgactatttgccagggattttgacagggacaaaaaacctctggcaaattt |
18912865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 40 - 240
Target Start/End: Original strand, 44407448 - 44407659
Alignment:
| Q |
40 |
actataagaaatatgct-atttgccagggattttgatagggacattaaacccttggcaaatttt----------agccaaggaaaatccccggtaaaatg |
128 |
Q |
| |
|
|||| |||||||||||| |||||||| ||||||||| |||||||| |||||| |||||||||| |||||||||||||||| | |||||| |
|
|
| T |
44407448 |
actacaagaaatatgctcatttgccaaggattttgacagggacatgaaacccctggcaaatttcccaaggcctaagccaaggaaaatccctagcaaaatg |
44407547 |
T |
 |
| Q |
129 |
acattgttaagtctgggaccacttaccatttgacagggatgagccccttacaaatgtacacatgcccctggattgagttgaccgcgaaatggaatttcaa |
228 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||| ||||||||||| ||||||| |||||||| |
|
|
| T |
44407548 |
acattgctaagtctgggaccacttaccatttgacaggggtgagcccctcacaaatgtacacctgcccctgggttgagttgaccacgaaatgaaatttcaa |
44407647 |
T |
 |
| Q |
229 |
attggctgacat |
240 |
Q |
| |
|
|||||||||||| |
|
|
| T |
44407648 |
attggctgacat |
44407659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 143 - 199
Target Start/End: Complemental strand, 1861485 - 1861429
Alignment:
| Q |
143 |
gggaccacttaccatttgacagggatgagccccttacaaatgtacacatgcccctgg |
199 |
Q |
| |
|
|||||||||||||| || |||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
1861485 |
gggaccacttaccacttaacaggggtgtgcccctcacaaatgtacacatgcccctgg |
1861429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 143 - 195
Target Start/End: Original strand, 20106281 - 20106333
Alignment:
| Q |
143 |
gggaccacttaccatttgacagggatgagccccttacaaatgtacacatgccc |
195 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||| ||||||||||||| |||| |
|
|
| T |
20106281 |
gggaccacttaccatttgacaggggtgaggccctcacaaatgtacacacgccc |
20106333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 143 - 195
Target Start/End: Complemental strand, 31324906 - 31324854
Alignment:
| Q |
143 |
gggaccacttaccatttgacagggatgagccccttacaaatgtacacatgccc |
195 |
Q |
| |
|
||||||||| |||||||||||||| |||| |||| ||||||||||||| |||| |
|
|
| T |
31324906 |
gggaccactaaccatttgacaggggtgaggccctcacaaatgtacacacgccc |
31324854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 272
Target Start/End: Original strand, 38172314 - 38172346
Alignment:
| Q |
240 |
tcaacggcgaagctagcaaaaagtttatgcagg |
272 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
38172314 |
tcaacggcgaagttagcaaaaagtttatgcagg |
38172346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 38 - 101
Target Start/End: Original strand, 47165462 - 47165526
Alignment:
| Q |
38 |
acactataagaaatatgct-atttgccagggattttgatagggacattaaacccttggcaaattt |
101 |
Q |
| |
|
|||||| |||||||||||| |||||| ||||||||||| |||||||| |||||| |||| ||||| |
|
|
| T |
47165462 |
acactacaagaaatatgctcatttgctagggattttgacagggacatgaaacccctggcgaattt |
47165526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 244 - 276
Target Start/End: Original strand, 42798706 - 42798738
Alignment:
| Q |
244 |
cggcgaagctagcaaaaagtttatgcaggggct |
276 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
42798706 |
cggcgaagctagcaaaaaatttatgcaggggct |
42798738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University