View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9092_low_13 (Length: 278)

Name: NF9092_low_13
Description: NF9092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9092_low_13
NF9092_low_13
[»] chr7 (1 HSPs)
chr7 (97-259)||(43751496-43751655)


Alignment Details
Target: chr7 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 97 - 259
Target Start/End: Original strand, 43751496 - 43751655
Alignment:
97 aataattacaattttaggctatgtccctttcttttattcnnnnnnnnnnnnggttgcaaatcgataatccctttcgaagctcgtagtagtatttttacgc 196  Q
    |||||||||||||||||||||||||||||||||||||||             ||||||||||||||||||||||||||||||||||||||||||||||||    
43751496 aataattacaattttaggctatgtccctttcttttattctttttttttt---gttgcaaatcgataatccctttcgaagctcgtagtagtatttttacgc 43751592  T
197 aagtttttaatagtttaaccaacaaccgaaaccaaatacaaaaaattaaccgccaacaccaaa 259  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43751593 aagtttttaatagtttaaccaacaaccgaaaccaaatacaaaaaattaaccgccaacaccaaa 43751655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University