View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9092_low_13 (Length: 278)
Name: NF9092_low_13
Description: NF9092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9092_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 97 - 259
Target Start/End: Original strand, 43751496 - 43751655
Alignment:
| Q |
97 |
aataattacaattttaggctatgtccctttcttttattcnnnnnnnnnnnnggttgcaaatcgataatccctttcgaagctcgtagtagtatttttacgc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43751496 |
aataattacaattttaggctatgtccctttcttttattctttttttttt---gttgcaaatcgataatccctttcgaagctcgtagtagtatttttacgc |
43751592 |
T |
 |
| Q |
197 |
aagtttttaatagtttaaccaacaaccgaaaccaaatacaaaaaattaaccgccaacaccaaa |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43751593 |
aagtttttaatagtttaaccaacaaccgaaaccaaatacaaaaaattaaccgccaacaccaaa |
43751655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University