View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9092_low_6 (Length: 501)
Name: NF9092_low_6
Description: NF9092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9092_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 2e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 298 - 483
Target Start/End: Complemental strand, 38701218 - 38701033
Alignment:
| Q |
298 |
gggaaaagatgttaaagaagaaactttacccttccatttagggccatagtgatgttatgaggaagaaagggattagagcttattggtggagcgagaaggt |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38701218 |
gggaaaagatgttaaagaagaaactttacccttccatttaggaccatagtgatgttatgaggaagaaagggattagagtttattggtggagcgagaaggt |
38701119 |
T |
|
| Q |
398 |
atcccaagtaatatttggtctagtgaaggtttagttttttgggtagttgttgccttgttgggttgtaaatttattgtcggggaagt |
483 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38701118 |
atcccaagtaatatttggtctagtgaaggtttagttttttgggtagttgttgccttattgggttgtaaatttattgtcggggaagt |
38701033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 165 - 236
Target Start/End: Original strand, 48888451 - 48888522
Alignment:
| Q |
165 |
tttttctgttttggcgttgttgccgtcaccgtgtatttgtacttctcgtatatttcggtgttaataatataa |
236 |
Q |
| |
|
|||||||||||||||||| | |||||| || |||| |||||| ||| ||||| || |||||||||||||||| |
|
|
| T |
48888451 |
tttttctgttttggcgttttagccgtcgccttgtaattgtacctcttgtataatttggtgttaataatataa |
48888522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 166 - 244
Target Start/End: Original strand, 46971771 - 46971849
Alignment:
| Q |
166 |
ttttctgttttggcgttgttgccgtcaccgtgtatttgtacttctcgtatatttcggtgttaataatataagcagtttc |
244 |
Q |
| |
|
||||||||| ||||||| | |||| ||| ||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
46971771 |
ttttctgttctggcgttatggccgacactttgtatttgtacttcttgtatatttcggtgttaataatataagctgtttc |
46971849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 212 - 244
Target Start/End: Original strand, 3783194 - 3783226
Alignment:
| Q |
212 |
gtatatttcggtgttaataatataagcagtttc |
244 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
3783194 |
gtatatttcggtgttaataatataagctgtttc |
3783226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University