View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9095_low_18 (Length: 262)
Name: NF9095_low_18
Description: NF9095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9095_low_18 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 35 - 262
Target Start/End: Original strand, 9234006 - 9234239
Alignment:
| Q |
35 |
gtgaataagggaaaaatttgtttgtttcacaccaacttttgcgtcacaggctcactattatcgtccgtaaactgcaaatgagcggtatgaaattactttt |
134 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9234006 |
gtgaataacggaaaaatttgtttgtgtcacaccaacttttgcgtcacaggctcactattatcgtccgtaaactgcaaatgagcggtatgaaattactttt |
9234105 |
T |
 |
| Q |
135 |
catttgcattgaaagattctactgagtcaaacgaaggaggtaatgaggcagacgacaccatgggt------atcatcatcatcatgtctagactattaac |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
9234106 |
catttgcattgaaagattctactgagtcaaacgaaggaggtaatgaggcagacgacaccatgggtatcatcatcatcatcatcatgtgtagactattaac |
9234205 |
T |
 |
| Q |
229 |
agttgtaactgctagtgtacttgttacagtactg |
262 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
9234206 |
agttgtaactgctggtgtacttgttacagtactg |
9234239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University