View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9095_low_23 (Length: 233)
Name: NF9095_low_23
Description: NF9095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9095_low_23 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 233
Target Start/End: Original strand, 7036520 - 7036736
Alignment:
| Q |
18 |
ccaccagtccttcaaattgatctaaatgcaacaagatatctttttgaaataccgaggaaactcctagctaccaaaaccggacactnnnnnnnn-ggacga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7036520 |
ccaccagtccttcaaattgatctaaatgcaacaagatatctttttgaaataccgaggaaactcctagctaccaaaaccggacactaaaaaaaaaggacga |
7036619 |
T |
|
| Q |
117 |
gaaaccgattctttaactccacaatctcctacacactgaagggatccttgacctacgactcctcttctaaataagttatctttggtagctattttattct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7036620 |
gaaaccgattctttaactccacaatctcctacacactgaagggatccttgacctacgactcctcttctaaataagttatctttggtagctattttattct |
7036719 |
T |
|
| Q |
217 |
gaaataatctccaagct |
233 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
7036720 |
gaaataatctccaagct |
7036736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University