View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9096_high_1 (Length: 498)
Name: NF9096_high_1
Description: NF9096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9096_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 393; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 393; E-Value: 0
Query Start/End: Original strand, 24 - 428
Target Start/End: Complemental strand, 37834920 - 37834516
Alignment:
| Q |
24 |
gtgattggagatgggaaaggcacgaatttttggatggagcgatggagacaacttgcgtcatctctttagtagagtttatgatatatcgcttgataaagat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37834920 |
gtgattggagatgggaaaggcacgaatttttggatggagcgatggagacaacttgcgtcatctctttagtagagtttatgatatatcgcttgataaagat |
37834821 |
T |
 |
| Q |
124 |
aaatgcctagcagatatgattgttgaaggagttggagaagaaggttgtttcaacgggaggaggaaatggtttggttcttggagttgagaagttggagggt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37834820 |
aaatgcctagcagatatgattgttgaaggagttggagaagaaggttgtttcaacgggaggaggaaacggtttggttcttggagttgagaagttggagggt |
37834721 |
T |
 |
| Q |
224 |
gggacaggaagatgtttggaagtgaggagagtcgagtttctcagttaaggtagcttaccatttgttaggattcctagtttcctactcaggaaaatcttag |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37834720 |
gggacaggaagatgtttggaagtgaggagagtcgagtttctcagttaaggtagcttaccatttgttaggattcctagtttcctactgaggaaaatcttag |
37834621 |
T |
 |
| Q |
324 |
taaaagaggggtgaacctgaactcttcttctctatgtgttggtggattgtggcagagttgaaacaaaaaatcatatattttttggttgtccaattttatc |
423 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37834620 |
taaaagaggggtgaacctgaactcttcttctctatgtgttggtggattgtggcagagttgaaacaaaaaatcatatattttttggtcgtccaattttatc |
37834521 |
T |
 |
| Q |
424 |
tgttg |
428 |
Q |
| |
|
||||| |
|
|
| T |
37834520 |
tgttg |
37834516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 424 - 475
Target Start/End: Complemental strand, 37834478 - 37834427
Alignment:
| Q |
424 |
tgttggagtctagtcccgtctgattgtgcacaggggtctggttctggttctg |
475 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
37834478 |
tgttggagtctagtcctgtctgattgtgcacaggggtctggttctggctctg |
37834427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University