View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9096_low_29 (Length: 282)
Name: NF9096_low_29
Description: NF9096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9096_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 94 - 264
Target Start/End: Original strand, 52955743 - 52955912
Alignment:
| Q |
94 |
gtgcagttttgggtactgctaagttgttcaattttactgattttgtgtccagcttttccagtttttaggagctgttgcgattgaatagtgctgnnnnnnn |
193 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52955743 |
gtgctgttttgggtactgctaaggtgttcaattttactgattttgtgtccagcttttccagtttttaggagctgttgcgattgaatggtgctg-tttttt |
52955841 |
T |
|
| Q |
194 |
atttatggctctgtcgaccgcctttgtgtatgcactaggctgcatttgtagtcccgtttctggccatttat |
264 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52955842 |
atttatggctctgtcgaccacctttgtgaatgcactaggctgcatttgtagtcctgtttctggccatttat |
52955912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 11 - 67
Target Start/End: Complemental strand, 42714761 - 42714705
Alignment:
| Q |
11 |
agtttggtggtgggactattttttgatcttctgttatgctgtgttggtctgttatga |
67 |
Q |
| |
|
|||||||||||||||||||||||||| || |||| |||||||||| |||||||||| |
|
|
| T |
42714761 |
agtttggtggtgggactattttttgacctcctgtgttgctgtgttgatctgttatga |
42714705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University