View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9096_low_31 (Length: 274)
Name: NF9096_low_31
Description: NF9096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9096_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 29656446 - 29656703
Alignment:
| Q |
1 |
acctaaatggatacaccatcttcattaatgggttattttcattggctatatatgtctagtctagagcattctttgacgta----atatgctctaatttcc |
96 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29656446 |
acctaaatggatacaccatcttcgttaatcggttattttcattggctatatatgtctagtctagagcattctttgacgtaatttatatgctctaatttcc |
29656545 |
T |
 |
| Q |
97 |
attttacttctctcttataagcagcttctagcagaatagtatttcaatgaccctcattctatcatttccctttctctacatactt-gtagtttctagtgt |
195 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29656546 |
attttacttttctcttataagcagcttctagcagaatagtatttcaatgac-----ttctatcatttccctttctctacatacttggtagtttctagtgt |
29656640 |
T |
 |
| Q |
196 |
agnnnnnnnnnngaaaaagtttatagtgtaaatttcttggtacaaactagacatccgtgtttt |
258 |
Q |
| |
|
|| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29656641 |
agttttttttttttaaaagtttctagtgtaaatttcttggtacaaactagacatccgtgtttt |
29656703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University